SolveItNCERT · CBSE Boards

CBSE 2024 · Region 3 · Set 1 · Q19 · 2 marks

Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow : \[\text { mRNA } 5^{\prime} \text { - UCAUUACCACGAUUCUUUAAAAGA - } 3 \text { ' } \]
(a)
How many amino acids will be formed from the given codons, if substitution of 'U' by 'C' takes place at the $\displaystyle 5^{\text {th }}$ codon? Explain your answer.
(b)
Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth codon instead of 'C' there is 'U'. Justify your answer.

Molecular Basis of InheritanceTranslationAnalysevery_short_answermedium

More from Molecular Basis of Inheritance

CBSE Class 12 Biology past-paper question from the 2024board exam, with the answer as CBSE’s own marking scheme gives it. Where our answers come from.