✓ Board-verified
Biology · 2024 · 2 marks
CBSE 2024 · Region 3 · Set 1 · Q19
Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow:…
Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow : \[\text { mRNA } 5^{\prime} \text { - UCAUUACCACGAUUCUUUAAAAGA - } 3 \text { ' } \]
(a)
How many amino acids will be formed from the given codons, if substitution of 'U' by 'C' takes place at the $\displaystyle 5^{\text {th }}$ codon? Explain your answer.
(b)
Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth codon instead of 'C' there is 'U'. Justify your answer.
Marking-scheme solution
(a)
$\displaystyle 8$ amino acids, genetic code is read in triplets and there is no change in the number of
triplets/ no change in reading frame.
(b)
$\displaystyle 3$ amino acids , the 4th codon now reads as UGA – a stop codon
All Molecular Basis of Inheritance questions2024 question paperNCERT solutions: Molecular Basis of InheritancePractice Molecular Basis of Inheritance →
More from Molecular Basis of Inheritance
- A bacterium having radioactive thymidine in its DNA is allowed to multiply in a medium having non-radioactive thymidine for two generations. What…2026
- Assertion: Repetitive sequences are stretches of DNA sequences that are thought to have no direct coding functions. Reason (R): They shed light on…2026
- Explain how the addition of lactose in the medium regulates the switching on of the lac operon in bacteria.2025
- In a human, the average gene consists of (i) bases and the largest known human gene contains (ii) bases. Select the correct option to fill in the…2026
- In a translational unit UTRs are present at:2025
- The simplest definition of a gene in eukaryotes is - A unit of DNA that has information to mainly specify the synthesis of:2025
- Explain the processing of heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this processing occur in the cell?2024
- The type of bond represented by the dotted line '-----' in a schematic polynucleotide chain is:2024
CBSE Class 12 Biology past-paper question from the 2024 board exam, with the answer as CBSE’s own marking scheme gives it. Where our answers come from.