CBSE 2024 · Region 3 · Set 1 · Q19 · 2 marks
Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow : \[\text { mRNA } 5^{\prime} \text { - UCAUUACCACGAUUCUUUAAAAGA - } 3 \text { ' } \](a)How many amino acids will be formed from the given codons, if substitution of 'U' by 'C' takes place at the $\displaystyle 5^{\text {th }}$ codon? Explain your answer.(b)Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth codon instead of 'C' there is 'U'. Justify your answer.
Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow : \[\text { mRNA } 5^{\prime} \text { - UCAUUACCACGAUUCUUUAAAAGA - } 3 \text { ' } \]
(a)
How many amino acids will be formed from the given codons, if substitution of 'U' by 'C' takes place at the $\displaystyle 5^{\text {th }}$ codon? Explain your answer.
(b)
Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth codon instead of 'C' there is 'U'. Justify your answer.
Marking-scheme solution
(a)
$\displaystyle 8$ amino acids, genetic code is read in triplets and there is no change in the number of
triplets/ no change in reading frame.
(b)
$\displaystyle 3$ amino acids , the 4th codon now reads as UGA – a stop codon
Molecular Basis of InheritanceTranslationAnalysevery_short_answermedium
More from Molecular Basis of Inheritance
- Explain how the addition of lactose in the medium regulates the switching on of the lac operon in bacteria.2025 · asked 3×
- The type of bond represented by the dotted line '-----' in a schematic polynucleotide chain is:2024 · asked 3×
- Which of the options has correct identification of 'P', 'Q' and 'R' in the illustration of 'Central Dogma'…2024 · asked 3×
- Study the diagram given below and answer the questions that follows: Identify the structure shown in the…2025 · asked 3×
- What is a genetic code? Why did scientists feel the need to propose a genetic code? Genetic code is said to…2026 · asked 3×
- Assertion: Primary transcripts in eukaryotes are subjected to splicing to remove the introns. Reason (R):…2024 · asked 3×
- Given below is a heterogeneous RNA formed during Eukaryotic transcription: How many introns and exons…2025 · asked 3×
- The correct depiction of the experiment performed by Matthew Meselson and Franklin Stahl to prove that DNA…2025 · asked 3×
CBSE Class 12 Biology past-paper question from the 2024board exam, with the answer as CBSE’s own marking scheme gives it. Where our answers come from.