Zoology · 2024
NEET 2024 · 5 May · Code T1 · Q164
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Which one is the correct product of DNA dependent RNA polymerase to the given template?
$\displaystyle 3$'TACATGGCAAATATCCATTCA5'
Official answer
From NTA’s final answer key for this paper.
(3)
$\displaystyle 5$'AUGUACCGUUUAUAGGUAAGU3'
More from Molecular Basis of Inheritance
- Histones are enriched with -2025
- Match List I with List II: List I A. RNA polymerase III B. Termination of transcription C. Splicing of Exons…2024
- Who proposed that the genetic code for amino acids should be made up of three nucleotides?2025
- Which chromosome in the human genome has the highest number of genes?2025
- Given below are two statements: Statement I: In the RNA world, RNA is considered the first genetic material…2025
- Which of the following statements are correct with reference to packaging of DNA helix? A. Histones are…2026
- Arrange the following steps of DNA fingerprinting in a correct sequence. A. Isolation of DNA and its…2026
NEET (UG) 2024 Zoology question, with the answer from NTA’s final answer key. Where our answers come from.