SolveItNEET (UG)
Zoology · 2024

NEET 2024 · 5 May · Code T1 · Q164

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

Which one is the correct product of DNA dependent RNA polymerase to the given template? $\displaystyle 3$'TACATGGCAAATATCCATTCA5'
ShareWhatsAppTelegram

More from Molecular Basis of Inheritance

NEET (UG) 2024 Zoology question, with the answer from NTA’s final answer key. Where our answers come from.