Transcription

NEET Zoology · Molecular Basis of Inheritance · 2 questions, latest first

• Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'20245 May · Q164
• Match List I with List II: List I A. RNA polymerase III B. Termination of transcription C. Splicing of Exons D. TATA box List II…20245 May · Q194