✓ Board-verified
Biology · 2023 · 1 mark
CBSE 2023 · Region 5 · Set 2 · Q7
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon…
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position $\displaystyle 3$ and codon position $\displaystyle 5$ during the process of its translation. $\displaystyle 1$ $\displaystyle 3$' AUCAGGUUUGUGAUGGUACGA $\displaystyle 5$'
There is no official answer for this question on the site.
All Molecular Basis of Inheritance questions2023 question paperNCERT solutions: Molecular Basis of InheritancePractice Molecular Basis of Inheritance →
More from Molecular Basis of Inheritance
- A bacterium having radioactive thymidine in its DNA is allowed to multiply in a medium having non-radioactive thymidine for two generations. What…2026
- Assertion: Repetitive sequences are stretches of DNA sequences that are thought to have no direct coding functions. Reason (R): They shed light on…2026
- Explain how the addition of lactose in the medium regulates the switching on of the lac operon in bacteria.2025
- In a human, the average gene consists of (i) bases and the largest known human gene contains (ii) bases. Select the correct option to fill in the…2026
- In a translational unit UTRs are present at:2025
- The simplest definition of a gene in eukaryotes is - A unit of DNA that has information to mainly specify the synthesis of:2025
- Explain the processing of heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this processing occur in the cell?2024
- The type of bond represented by the dotted line '-----' in a schematic polynucleotide chain is:2024
CBSE Class 12 Biology past-paper question from the 2023 board exam. Where our answers come from.