CBSE 2025 · Region 4 · Set 1 · Q18 · 2 marks

Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames.

(a)

Translation starting from the first nucleotide (Reading frame $\displaystyle 1$)

(b)

Translation starting from the second nucleotide (Reading frame $\displaystyle 2$) Frame $\displaystyle 1$ $\displaystyle 5^{\prime}$ - CUCGCUUGCCGAUCAAGGGUUA - $\displaystyle 3$' Frame $\displaystyle 2$ $\displaystyle 5$' - GUGGCACUCAGUCCUUAAUGGCG - $\displaystyle 3$' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.

CBSE Class 12 Biology past-paper question from the 2025board exam, with the answer as CBSE’s own marking scheme gives it. Where our answers come from.