Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. (a) Translation starting from the first…

Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames.

Translation starting from the first nucleotide (Reading frame $\displaystyle 1$)

Translation starting from the second nucleotide (Reading frame $\displaystyle 2$) Frame $\displaystyle 1$ $\displaystyle 5^{\prime}$ - CUCGCUUGCCGAUCAAGGGUUA - $\displaystyle 3$' Frame $\displaystyle 2$ $\displaystyle 5$' - GUGGCACUCAGUCCUUAAUGGCG - $\displaystyle 3$' Answer the following question : How many amino acids will be specified in case (a) and case (b) on translation ? Justify your answer.